Alignment description

BS  Sequence segment (including gaps); Site link; Start; Length; Gaps; Orientation.

Examples:
BS  TGTTTGTCAAT; R08890; 9; 11;; p.             derived from TRANSFAC site    R08890
BS  TATTTACTTTC; C00278,  s00475; 2; 11;; n.    derived from TRANSCompel site s00475
                                                         in composite element C00278

The positions given refer to the sequence as shown in the site table.

For re-construction of alignment from site sequence
1. introduce gaps at the indicated positions
2. determine matrix start
3. determine matrix length
4. orientation: p (positive), i.e. as in site entry / n (negative) = reverse complement


Examples:

BS    AATCCGGAAACGATG; R05296; 1; 17; 1, 2; p
    -----------------
                                                 1111111111
                                        1234567890123456789
Sequence in site entry:                 AATCCGGAAACGATGCG
1. positions of gaps: 1, 2              --AATCCGGAAACGATGCG
2. matrix start: 1                      --AATCCGGAAACGATGCG
3. matrix length: 17                    --AATCCGGAAACGATG
4. orientation: p



BS  CCTGGTCA ATGGGTCATG; R11613; 9; 19; 17; p
    -------------------
                                                 111111111122222222
                                        123456789012345678901234567
Sequence in site entry:                 GGGTCACTCCTGGTCAATGGGTCATG
1. positions of gaps: 17                GGGTCACTCCTGGTCA-ATGGGTCATG
2. matrix start: 9                              CCTGGTCA-ATGGGTCATG
3. matrix length: 19                            CCTGGTCA-ATGGGTCATG
4. orientation: p



BS    AACTACCGG; R08780; 1; 11; 10, 11; n.
    -----------
                                                 11
                                        12345678901
Sequence in site entry:                 CCGGTAGTT
1. positions of gaps: 10, 11            CCGGTAGTT--
2. matrix start: 1                      CCGGTAGTT--
3. matrix length: 11                    CCGGTAGTT--
4. orientation: n                       --AACTACCGG



BS  CATTACAAAATC; R00097; -1; 12;; n.
    ------------
                                                 11
                                      -112345678901
Sequence in site entry:                 ATTTTGTAAT
1. positions of gaps: -                 ATTTTGTAAT
2. matrix start: -1                    GATTTTGTAAT
3. matrix length: 12                   GATTTTGTAATG
4. orientation: n                      CATTACAAAATC
(Flanking positions were retrieved from linked EMBL entry.)